dissabte, 19 de desembre de 2009

BON NADAL!! - FELIZ NAVIDAD!!

GUAU!!

MOLTES FELICITATS!!! - MUCHAS FELICIDADES!!!

MI FELICITACIÓN

Os dejo una foto del tiet Ross de Perro Noël!!!

dilluns, 7 de desembre de 2009

UN IDÈFIX QUE ENS HA DEIXAT - UN IDEFIX QUE NOS HA DEJADO

GUAU!

He rebut aquest missatge:

Hola,


sento molt dir-te q se'm va morir l'Idèfix fa 10 dies. Al febrer hagués fet 17 anys... tot i q ha viscut molts anys, la seva pèrdua ha estat un cop durillo ...

Et passo 2 fotos, una d quan tenia un anyet i l'altra de fa un mes.. no vegis com va canviar !

No res, q gaudeixis molt del teu Idèfix... no crec q tardi massa a tenir un Idèfix II ( però encara em queden 2 gosses més !)

Fins la propera Montse Sambró .

Segur que aquest Idèfix està feliç corrent pels boscos amb el primer Idèfix buscant senglars.

-------------------------------------------
He recibido este mensaje:

Hola,


siento mucho decirte q se me murió Idéfix hace 10 días.
En febrero hubiera hecho 17 años ... todo yq ha vivido muchos años, su pérdida ha sido un golpe durillo ...


Te paso 2 fotos, una de cuando tenía un añito y la otra hace un mes .. no veas como cambió!

Nada, q disfrutes mucho de tu Idéfix ... no creo q tarde demasiado en tener un Idéfix II (pero aún me quedan 2 perras más!)

Hasta la próxima

Montse Sambró.

Seguro que este Idéfix es feliz corriendo por los bosques con el prim
er Idéfix buscando jabalíes.

GUAUA


dissabte, 28 de novembre de 2009

LA LLEONA!!!!!!!!! - LA LEONA!!!!!!!!!!!!

GUAUA!

Desprès diuen que són els més intel·ligents!! Cap de nosaltres haguessin posat la pota d'aquesta manera. GRRRRRRRRRRR!!!!!
---------------------------------------------------------------------------------------------------------------

Luego dicen que son los más inteligentes. Ninguno de nosotros hubiese metido la pata de esta manera. GRRRRRRRRRRRRRRRR!!!!!


GUAU!

dilluns, 16 de novembre de 2009

UN ALTRE WEB - OTRA WEB

GUAUU!

El papi m'ha obert aquesta pàgina web. La coneixeu?
I a la Pija aquesta.
-------------------------------------------------

Papi me ha abierto esta página web. La conocíais?
Y a la Pija esta.


GUAUAU

diumenge, 15 de novembre de 2009

EL SO DE LA RADIO - EL SONIDO DE LA RADIO

GUAU!

He tardat una mica però us poso el so del que va sortir per radio a RAC1 l'altre dia.
-------------------------------------------------------------------
He tardado un poco pero os pongo el sonido de lo que se emitió por RAC1 el otro dia.

dimecres, 11 de novembre de 2009

Cáceres

ARF ARF ARF!

Avui estic molt enfeinat. M'han demanat que recolzi la candidatura de Càceres per Capital Europea de la Cultura del 2016 i com que sóc molt generós ho he fet. Segur que així s'ho fan.

------------------------------------------------------------------------------------------------------------------------


Hoy estoy muy ocupado. Me han pedido que apoye la candidatura de Cáceres para Capital Europea de la Cultura del 2016 y como soy muy generoso lo he hecho. Seguro que así se lo dan.


GUAUAU

Em criden des de Cannes - Me reclaman desde Cannes

Guau!

Com que he sortit als diaris i a la radio m'han avisat des de Cannes pel festival de cinema.

---------------------------------------------------------------------------------------------------------

Como que he salido en los periódicos y en la radio, me han avisado desde Cannes para el festival de Cine.


GUAU

Idèfix a RAC1

GUAUUUUUUUUUU!!!

Aquest matí a l'emissora de radio RAC1, al programa "El Mon a RAC1" han donat la notícia del meu Blog!!!!!! Han dit que faig les meves reflexions, però que com cap dels de dues potes entén el llenguatge comú dels gossets em tinc que explicar mitjançant el papi. arf! arf! arf!!!!! Mireu aquí!!!

Demà us posaré el só!

-------------------------------------------------------------------------------------------------------------------------------

Esta mañana en la emisora de radio RAC1, el programa "El Mon a RAC1" han dado la noticia de mi Blog !!!!!! Han dicho que hago mis reflexiones, pero que como ninguno de los de dos patas entiende el lenguaje común de los perritos me tengo que explicar a través de mi papi. ARF!! ARF!! ARF!! Mirad aquí!!

Mañana os pongo el sonido.

GUAUUUUUUUUUUUUUUUUU!!!

divendres, 30 d’octubre de 2009

50e ANIVERSARI - 50º CUMPLEAÑOS

Ahir el meu rebesavi Idèfix va fer 50 anys que va iniciar la saga del Idèfix.
--------------------------------------------------------------------------------------------------
Ayer mi bisabuelo Idèfix hizo 50 años que inició la saga de los Idèfix!!


dilluns, 21 de setembre de 2009

LES EXCURSIONS DE LES VACANCES - LAS EXCURSIONES DURANTE LAS VACACIONES

GUAU!

Os pongo unas excursiones que hemos hecho en estas vacaciones. ¿A que salgo guapo cara al viento?


2009-09-17-1143

Widget powered by EveryTrail: Share and Plan your Trips


2009-09-15-1022

Widget powered by EveryTrail: Geotagging Community

2009-09-14-0924

Widget powered by EveryTrail: Travel Community

dimarts, 1 de setembre de 2009

VACANCES - VACACIONES!!!

La setmana que ve me'n vaig de vacances.....guauuuuuuuuuuuuuuuuuuuuuuuuuuu!!!!!
------------------------------------------------------------------------------------------------------
La semana entrante me voy de vacaciones...........................................

L'excursió de la setmana - La excursión de la semana

GUAU!!

Si us recordeu ja us vaig comentar que cada setmana el papi anava amb el seu amic el Sr. Carlos y amb nosaltres a fer el que diu "Euromillones". Aquesta setmana igual. Us deixo unes fotos de record. A les tres primeres estem esperant al Sr. Carlos que surti de la feina i a les altres estic avorrit mirant com discuteixen quin números són els que posaran.

---------------------------------------------------------------------------------------------------------------------------

Si os acordáis ya os comenté que cada semana el papi iba con su amigo el Sr. Carlos y con nosotros a hacer lo que dice "Euromillones". Esta semana igual. Os dejo unas fotos de recuerdo. En las tres primeras estamos esperando al Sr. Carlos que salga del trabajo y a las demás estoy aburrido mirando como discuten qué números son los que pondrán.

GUAU!!!





dimarts, 11 d’agost de 2009

EL COTXE - EL COCHE

GUAU!

A mi m'agrada molt anar en cotxe, no com la Pija que sempre té por i s'amaga a terra. Sempre vaig amb les potes del darrere al seient del darrere i les de davant sobre els posa-braços dels seients davanters. L'altre dia vaig somiar que jo tenia un cotxe propi i que li posava el meu nom. Però veig que sempre n'hi ha que ja hi han pensat.

----------------------------------------------------------------------------------------

A mí me gusta mucho ir en coche, no como la Pija que siempre tiene miedo y se esconde en el suelo. Siempre voy con las patas traseras en el asiento trasero y las delanteras sobre los posa-brazos de los asientos delanteros. El otro día soñé que tenía un coche propio y que le ponía mi nombre. Pero veo que siempre hay gente que se ha adelantado.


GUAUAU!!

diumenge, 26 de juliol de 2009

Placa azul

Guau!

Mi papi nos ha inscrito a la Pija y a mi en esta web:

Placa azul

¿Qué es Placa Azul?

La Placa Azul es una iniciativa contra el abandono de mascotas. Su objetivo es que todas las mascotas lleven una Placa Azul identificativa y reivindicativa durante el verano de 2009.

¿Qué significa la Placa Azul?

La mascota que luce la Placa Azul denuncia el abandono de sus semejantes, y declara públicamente que su dueño no la puede abandonar.

¿Qué hay que hacer para conseguir la Placa Azul?

Lo que hacen miles de personas. Registrarse en esta Web. Nada más.

¿Cuánto cuesta la Placa Azul?

Nada. La Placa Azul y sus gastos de envío son completamente gratuitos.

¿Quién puede pedir la Placa Azul?

Todo el mundo. La Placa Azul es una iniciativa abierta a mascoteros y simpatizantes que crean que el abandono se debe y se puede erradicar.

¿Cuándo llegará mi Placa Azul?

El tiempo estimado del envío es de 7 a 14 días laborables (a partir de la fecha de solicitud).

¿Cómo llegará mi Placa Azul?

Te llegará como carta enviada por Correos de España.

¿Existe el abandono de animales en España?

Existe. Más de 150.000 abandonos anuales. Es una de las principales lacras de una sociedad desarrollada. Con la iniciativa Placa Azul pondremos todos los medios a nuestro alcance para llegar a un abandono cero.



GUAUAU

dissabte, 25 de juliol de 2009

EL VIATGE DELS PAPIS - EL VIAJE DE LOS PAPIS







GUAU!!
He estat dues setmanes a casa de la cosineta Amis ja que els papis s'han anat de vacances a Alemanya. Com han anat en avió m'han deixat aquí. Quan han tornat m'han ensenyat les fotos que han fet i m'he enfadat molt.
Aquí no ens deixen entrar en els menjadors públics dels humans, ni a les botigues, ni als transports. Per trobar un lloc on hi hagi borsa-caca-xuxo cal buscar i buscar. Als jardins hem d'anar amb correu i morrió.
NO HI HA DRET!
En canvi en altres països hi ha abeuradors d'aigua als jardins i a les portes de les botigues, ens deixen entrar als transports i també als restaurants i bars. I ningú s'estranya.
Per què no m'han portat de vacances ... ... ..
------------------------------------------------------------------------------------------------------------------
Guau!
He estado dos semanas en casa de la prima Amis ya que los papis se han ido de vacaciones a Alemania. Como han ido en avión me han dejado aquí. Cuando han vuelto me han enseñado las fotos que han hecho y me he enfadado mucho.
Aquí no nos dejan entrar en los comederos públicos de los humanos, ni en las tiendas, ni en los transportes. Para encontrar un expendedor de bolsa-caca-chucho hay que buscar y buscar. En los jardines tenemos que ir con correo y bozal.
NO HAY DERECHO!!!
En cambio en otros países hay bebederos de agua en los jardines y en las puertas de las tiendas, nos dejan entrar en los transportes y también en los restaurantes y bares. Y nadie se extraña.
Por qué no me han llevado de vacaciones……..

GUAU

dijous, 28 de maig de 2009

ARRF!!!! COOOPAAAAA....GUA GUA GUAU!!!



ARF! ARF!

GUAU!!!!!!!!!!!!!!!!!!!!! GUA!!!!!!!!!!!!!!!! GUUUUUUUUUUUUUUUUUUUUUUAU!

dimecres, 15 d’abril de 2009

LA MEVA FESTA D'ANIVERSARI - MI FIESTA DE CUMPLEAÑOS

GUAU!!

El diumenge passat vam celebrar el meu aniversari (que va ser el dia 30 de març). Tot i que li diem així, és l'aniversari del dia que vaig entrar a aquesta família. Ara dec tenir uns 5 anys. Us deixo un vídeo. No us perdeu lo tocat i posat que sóc quan el tiet Ernest em va fer la foto: primer sec, faig cara de circumstàncies i quan es fa la foto me'n vaig. Ho he aprés del futbolistes quan surten per la tele, arf,. arf. arf.
---------------------------------------------------------------------------------------------------------------------
El pasado domingo celebramos mi cumpleaños (que fue el día 30 de marzo). A pesar de que le llamamos así es el aniversario del día en que entré a formar parte de esta familia. Ahora debo tener unos 5 años. Os dejo el vídeo. No os perdais cómo me pongo cuando el tio Ernest me hizo la foto: primero me siento, luego pongo cara de circunstancias y, cuando se hace la foto, me voy. Lo he aprendido de los futbolistas cuando salen por la tele, arf. arf. arf!!

GUAU!!

dijous, 2 d’abril de 2009

AVUI HE TINGUT QUE ANAR A TREBALLAR! - HOY HE IDO AL TRABAJO!

GAUUA!

Avui he tingut que anar a treballar. Ja fa temps que el papi em comenta que no s'aclareixen a la seva feina. Per no sentir-lo més he tingut que fer un cop de cua i anar-hi jo. A les fotos em podeu veure donant instruccions al personal de com ha de fer la seva feina. Arf! Arf! he demanat un lot de GuauOptions a bon preu. Com que ha valorat molt bé la meva intervenció m'han dit que me les donaran. Convertibles en ossos de primera!!!!.
-----------------------------------------------------------------------------------------------------------------------------------------------
Hoy he tenido que ir al trabajo. Ya hace tiempo que mi papi me comenta que no se aclaran. Para no oirlo más he dado un colpe de cola y he ido a trabajar. En las fotos me podeis ver dando instrucciones al personal sobre cómo han de hacer su trabajo. Arf! Arf! he pedido un lote de GuauOptions a buen precio. Y como han valorado muy bien mi intervención me han dicho que me las darán. Convertibles en huesos de primera!!!!.
Si es que no se enteran!!!!!!!


GUAUA!!!

dilluns, 30 de març de 2009

AVUI ÉS EL MEU ANIVERSARI - HOY ES MI CUMPLEAÑOS

GUAUAUAU!!

Doncs sí, avui fa dos anys que estic aquí, amb els papis. L'any passat vam tenir una festa, i ara està prevista pel diumenge 12 d'abril. Però la Sara no podrà venir perquè, al final, a tingut els seus 9 cadells (els meus nebodets!) sense més problemes. Si no ve la Sara, tampoc vindrà en Klaus ni el tiet Ross. GRÑÑÑ!
-----------------------------------------------------------------------------------------
Pues sí, hoy hace dos años que estoy aquí, con los papis. El año pasado me hicieron una fiesta, y ahora está prevista para el domingo 12 de abril. Pero Sara no podrá venir, porque al final a tenido a sus 9 cachorros (mis sobrinitos!) sin problemas. Y si no viene Sara, tampoco lo hará Klaus ni el tio Ross!. GRÑÑÑ!!!

GUAU!

divendres, 27 de març de 2009

JA SÓC TIET - YA SOY TIO!!!

La Cosina Sara està parint. Ara va pel cadell nº 7. I en porta 9!! GAUUAUAUAUAUAUAUUUUUU!!!
---------------------------------------------------------------------------------------------------------------------------
La prima Sara está de parto. Ahora va por el cachorro nº 7. Y lleva 9!. AUUUUUUUUUUUUUUUUUUUUUU!!!!

divendres, 27 de febrer de 2009

FEINA - TRABAJO

GUAU!!

Ja sé que fa temps que no bordo res però és que estic molt ocupat, tal i com es pot veure a la foto.

---------------------------------------------------------------------------------------------------------------------

Ya sé que hace tiempo que no ladro nada pero es que estoy muy ocupado, tal y como podeis ver en la foto.

GUAU!!

dijous, 15 de gener de 2009

DE COPES -- DE COPAS

GUAU!!

arf arf arf!!! un cop a la setmana el papi se'n va amb el "Sr. Carlos" i jo a fer els "Euromillones". Són tant tontos que diuen que així es podran jubilar aviat. ARF ARF ARF!!!!!!!! Aqui em podeu veure fen la copeta ahir amb el "Sr. Carlos". La setmana que ve hi tornarem perquè es jubilaran quan tinguin 65 anys. JOJOJOJO!!!!!!

-----------------------------------------------------------------------------------------------------------------------------------------

Una vez por semana mi papi me lleva con el "Sr. Carlos" a hacer los Euromillones. Son tan tontos que dicen que así se podrán jubilar antes, jejejejej. Aquí me podeis ver tomando la copa, ayer, con el "Sr. Carlos". La semana que viene volveremos porque se jubilarán a los 65 años, ARF ARF ARF!!

GUAU!

dimecres, 7 de gener de 2009

La meva fitxa a Huesin - Mi ficha en Huesin

GUAU!!
El papi ha trobat aquesta pàgina web de gossos i m'hi ha apuntat. Hi ha molts gossets i gossetes.

-------------------------------------------------------------------------------------------------------------------------------

Mi papi me ha dicho que ha encontrado esta página web de perros y me ha apuntado. Hay muchos perritos y perritas.

GUAU

dijous, 1 de gener de 2009

2009

GUAU!!

ARFF ARFFF...........GRRRRRRRRRRRRRRRR..............BUP BUP...ARF ARF ARF..........GUAU GUAU......GRRRR.........ARF....2009........


NOTA DEL PAPI DE L'IDÈFIX: Està molt esvalotat i joganer, només fa que córrer i córrer tot content. No entenc el que em diu de tanta excitat que està. Només entenc 2009. Suposo que deu voler dir BON ANY 2009 A TOTS!!!!!

______________________________________________________________________________________________________________

NOTA DEL PAPI DE IDÈFIX: Está muy nervioso i juguetón. Sólo corre y corre muy contento. No entiendo bien lo que dice. Sólo algo del 2009. Supongo que debe querer decir FELIZ AÑO NUEVO 2009 A TODOS.